Q5EAQ5_DANRE

Ensembl ID:
ENSDARG00000041418
Description:
Cyp2b10 protein [Source:UniProtKB/TrEMBL;Acc:Q5EAQ5]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44054 Nonsense Mutation detected in F1 DNA During 2017
sa37787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060715 Nonsense 153 410 3 7
Genomic Location (Zv9):
Chromosome 23 (position 42965550)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42385409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGAGACGGTTTGCTCTGCACACACTCAGAAACTTTGGTCTGGGAAAG[A/T]AGTCTGTGGAGGAACGTGTGACGGAGGAAAGCGGTTACCTGATTTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060715 Nonsense 254 410 5 7
Genomic Location (Zv9):
Chromosome 23 (position 42960095)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42390864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATTTGCCAGGGCCACATCAGAAAATATATCAGAATGGAGAAGAATTT[A/T]AGTCTTTCATCAGGGAATCAGTCAAAGCACACAGAGAAACTCTGGATCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link