rad51

Ensembl ID:
ENSDARG00000041411
ZFIN ID:
ZDB-GENE-040426-2286
Description:
DNA repair protein RAD51 homolog 1 [Source:RefSeq peptide;Acc:NP_998371]
Human Orthologue:
RAD51
Human Description:
RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) [Source:HGNC Symbol;Acc:9817]
Mouse Orthologue:
Rad51
Mouse Description:
RAD51 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:97890]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23805 Nonsense Available for shipment Available now
sa25145 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060706 Nonsense 203 340 7 10
ENSDART00000113264 Nonsense 45 182 3 6
ENSDART00000143858 None None 45 None 3
Genomic Location:
Chromosome 20 (position 46688322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGATAACGTGGCCTACGCCAGAGCCTTCAACACTGACCATCAAACA[C/T]AGCTGCTGTATCAGGCCTCCGCTATGATGACCGAGTCCAGGTAACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060706 Nonsense 302 340 10 10
ENSDART00000113264 Nonsense 144 182 6 6
ENSDART00000143858 None None 45 None 3
Genomic Location:
Chromosome 20 (position 46692558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATTACACCCTAACGCCGCTCTTAATTGTGTCTCTATTGTAGGTTATA[C/A]CTTAGGAAAGGCAGAGGTGAGACGAGGATATGTAAGATCTATGACTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jf6fxlx9