fam82a2

Ensembl ID:
ENSDARG00000041407
ZFIN ID:
ZDB-GENE-041014-256
Description:
regulator of microtubule dynamics protein 3 [Source:RefSeq peptide;Acc:NP_001076519]
Human Orthologue:
FAM82A2
Human Description:
family with sequence similarity 82, member A2 [Source:HGNC Symbol;Acc:25550]
Mouse Orthologue:
Fam82a2
Mouse Description:
family with sequence similarity 82, member A2 Gene [Source:MGI Symbol;Acc:MGI:1915059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3104 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060702 Essential Splice Site 53 476 2 12
Genomic Location:
Chromosome 20 (position 46714335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTAGACATGTGTATATGACTCTGATGATGAGCTTGTGTGTGATTTCA[G/A]TGGATTCCTCRGCTCTTACTGCAGCRGTSCAAGGTTTGTCTCCTGATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qbew6ato