eif2b2

Ensembl ID:
ENSDARG00000041397
ZFIN ID:
ZDB-GENE-040426-2605
Description:
translation initiation factor eIF-2B subunit beta [Source:RefSeq peptide;Acc:NP_998068]
Human Orthologue:
EIF2B2
Human Description:
eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa [Source:HGNC Symbol;Acc:3258]
Mouse Orthologue:
Eif2b2
Mouse Description:
eukaryotic translation initiation factor 2B, subunit 2 beta Gene [Source:MGI Symbol;Acc:MGI:2145118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17223 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060689 Essential Splice Site 235 355 5 8
Genomic Location:
Chromosome 20 (position 46777275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCATCCCAGACGCCGCCATCTTTGCTGTAATGTCACGAGTCAATAAG[G/A]TGAAATAAAAGATTAATCCTGCGAAGTGCTCTGAAATGTGCACTTTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u1v2wbmd