si:ch211-245j22.3

Ensembl ID:
ENSDARG00000041379
ZFIN ID:
ZDB-GENE-050419-38
Description:
hypothetical protein LOC563798 [Source:RefSeq peptide;Acc:NP_001074270]
Human Orthologue:
GUCA1B
Human Description:
guanylate cyclase activator 1B (retina) [Source:HGNC Symbol;Acc:4679]
Mouse Orthologue:
Guca1b
Mouse Description:
guanylate cyclase activator 1B Gene [Source:MGI Symbol;Acc:MGI:1194489]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43071 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061681 Essential Splice Site 154 194 5 5
Genomic Location (Zv9):
Chromosome 18 (position 15233655)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15586067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTTGCTGTACGAGTGTGCTCATGTCATTGTTTTTTTCTGTCTCTATA[G/A]CCATCATCAGTCAAGATGAGTTCATTGAAGGCGCACTGAATGACGAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link