ttk

Ensembl ID:
ENSDARG00000041361
ZFIN ID:
ZDB-GENE-030123-1
Description:
Dual specificity protein kinase Ttk [Source:UniProtKB/Swiss-Prot;Acc:Q8AYG3]
Human Orthologue:
TTK
Human Description:
TTK protein kinase [Source:HGNC Symbol;Acc:12401]
Mouse Orthologue:
Ttk
Mouse Description:
Ttk protein kinase Gene [Source:MGI Symbol;Acc:MGI:1194921]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11341 Essential Splice Site Available for shipment Available now
sa18112 Nonsense Available for shipment Available now
sa25000 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Essential Splice Site 29 982 2 25
ENSDART00000131876 Essential Splice Site 29 983 2 25
ENSDART00000138654 None None 160 None 5
Genomic Location:
Chromosome 16 (position 6375630)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATGCTGTGTCAAAAGCTGGCCATGATGAAGCAATTGTTCAATGAAG[G/A]TAATCGATTTATTAATTAGTTTNTTTTCAGRATTCCTAATGTAGGATTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Nonsense 587 982 15 25
ENSDART00000131876 Nonsense 588 983 15 25
ENSDART00000138654 None None 160 None 5
Genomic Location:
Chromosome 16 (position 6358571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTCTTCGATTAAACCCCTCACTCAGCTGTCAGACGCCCAACTACAGA[C/T]AGCCAAATCCTAACAGGTGATGAGARCACAGATAAAYATGTGGATTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Nonsense 961 982 25 25
ENSDART00000131876 Nonsense 962 983 25 25
ENSDART00000138654 Nonsense 139 160 5 5
Genomic Location:
Chromosome 16 (position 6344817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCGTTAACCTTTAGCCTCTGTCTCTGCAGAATTTAGCCATGATGTG[C/A]AACAGCGGGAGGAAACTGGATGTTTCTGAATGTGTGAAAAGCTCCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ie4wxem