lgi3

Ensembl ID:
ENSDARG00000041358
ZFIN ID:
ZDB-GENE-060217-4
Description:
leucine-rich repeat LGI family member 3 [Source:RefSeq peptide;Acc:NP_001034768]
Human Orthologue:
LGI3
Human Description:
leucine-rich repeat LGI family, member 3 [Source:HGNC Symbol;Acc:18711]
Mouse Orthologue:
Lgi3
Mouse Description:
leucine-rich repeat LGI family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2182619]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12143 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060625 Nonsense 478 551 9 9
Genomic Location:
Chromosome 8 (position 53653651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAACCCTGCCATCTAGGGGCTCAATGGCCGTGTATCCCTTCRGCGTC[G/T]GAGTGAGGCTTTACCTCCTGCTRGGCAGCGATTATTCCTTCTCCAGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6xgfyyz9