cyp19a1a

Ensembl ID:
ENSDARG00000041348
ZFIN ID:
ZDB-GENE-990415-43
Description:
Cytochrome P450 19A1a [Source:UniProtKB/Swiss-Prot;Acc:O42145]
Human Orthologue:
CYP19A1
Human Description:
cytochrome P450, family 19, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2594]
Mouse Orthologue:
Cyp19a1
Mouse Description:
cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88587]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7241 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124001 Essential Splice Site 247 481 6 9
ENSDART00000129828 None 282 517 6 9
Genomic Location:
Chromosome 18 (position 38061678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTAGTCAGGAGTTGCAGGATGCCATCACAGCTCTGATCGAGCAGAA[G/A]AAAGTTCAACTGGYACACGCAGAGAAACTYGACCACCTCGACTTTACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association study in Han Chinese identifies three novel loci for human height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)
  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
  • Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bxorf4cd