mrpl15

Ensembl ID:
ENSDARG00000041338
ZFIN ID:
ZDB-GENE-040801-168
Description:
39S ribosomal protein L15, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6DGM3]
Human Orthologue:
MRPL15
Human Description:
mitochondrial ribosomal protein L15 [Source:HGNC Symbol;Acc:14054]
Mouse Orthologue:
Mrpl15
Mouse Description:
mitochondrial ribosomal protein L15 Gene [Source:MGI Symbol;Acc:MGI:1351639]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14548 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060592 Nonsense 185 296 4 5
Genomic Location:
Chromosome 7 (position 65356865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGAAATGGGGGTGTTATCACAACCAGCTACTACGATCCACGGAGCCTC[C/T]GTTAGTATACTTACACTCTTAAGGCTGATTTATACTTCTGCGTCAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zyiym9r0