tmem33

Ensembl ID:
ENSDARG00000041332
ZFIN ID:
ZDB-GENE-030131-5425
Description:
transmembrane protein 33 [Source:RefSeq peptide;Acc:NP_998828]
Human Orthologue:
TMEM33
Human Description:
transmembrane protein 33 [Source:HGNC Symbol;Acc:25541]
Mouse Orthologue:
Tmem33
Mouse Description:
transmembrane protein 33 Gene [Source:MGI Symbol;Acc:MGI:1915128]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19098 Nonsense Mutation detected in F1 DNA During 2014
sa9069 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060577 Nonsense 229 252 8 8
ENSDART00000060577 Nonsense 229 252 8 8
Genomic Location:
Chromosome 14 (position 49300474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAGAGCTGCGCATCTTACTGGAGCATTTTGTGATGAAGCCCAGCTG[T/A]CCCGTCTTCTTCAGGAGGATGTGCCTCAACAGCATTGCCTTCGTTAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060577 Nonsense 229 252 8 8
ENSDART00000060577 Nonsense 229 252 8 8
Genomic Location:
Chromosome 14 (position 49300474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACAGAGCTGCGCATCTTACTGGAGCATTTTGTGATGAAGCCCAGCTG[T/A]CCCGTCTTCTTCAGGAGGATGTGCCTCAACAGCATTGCCTTCGTTAGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lz9cvu0m