mrps25

Ensembl ID:
ENSDARG00000041306
ZFIN ID:
ZDB-GENE-050417-52
Description:
28S ribosomal protein S25, mitochondrial [Source:RefSeq peptide;Acc:NP_001017590]
Human Orthologue:
MRPS25
Human Description:
mitochondrial ribosomal protein S25 [Source:HGNC Symbol;Acc:14511]
Mouse Orthologue:
Mrps25
Mouse Description:
mitochondrial ribosomal protein S25 Gene [Source:MGI Symbol;Acc:MGI:1928140]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14732 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060542 Essential Splice Site 45 173 1 4
Genomic Location:
Chromosome 8 (position 55362946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGACCGTCAATTATAACACACATGGAGACCTGAGTGAAGGAGCAAGG[T/G]CAGACATAAACAATAACCGTCTTTATTAGCTGAAAACAATACGATTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r9vme3cr