si:ch73-138e9.2

Ensembl ID:
ENSDARG00000041304
ZFIN ID:
ZDB-GENE-100922-182
Human Orthologue:
TRAK1
Human Description:
trafficking protein, kinesin binding 1 [Source:HGNC Symbol;Acc:29947]
Mouse Orthologue:
Trak1
Mouse Description:
trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22744 Nonsense Available for shipment Available now
sa2869 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa22744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085678 Nonsense 43 911 1 18
ENSDART00000136936   None 860 2 16

The following transcripts of ENSDARG00000041304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 7107335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5951866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTATAAGCTGAGAGCCGACACTATATACGGCTATGATCACGACGACTG[G/A]CTCCACACGCCTCTCATCTCCCCCGACGTCAACCTCGACCTGACCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2869
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085678 Nonsense 439 911 11 18
ENSDART00000136936 Nonsense 361 860 12 16

The following transcripts of ENSDARG00000041304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 7064604)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5909135
KASP Assay ID:
554-3194.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATGTAYGGTGGAGACGGYRTGGAGATAGACAACCGCACTAACAGTT[T/A]ACTGCTGGAAACACAGTCTCCWCAGGATGGGTAAGAGAATCCAACRGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link