noxo1

Ensembl ID:
ENSDARG00000041294
ZFIN IDs:
ZDB-GENE-030131-9700, ZDB-GENE-060929-852
Description:
hypothetical protein LOC572245 [Source:RefSeq peptide;Acc:NP_001071052]
Human Orthologue:
NOXO1
Human Description:
NADPH oxidase organizer 1 [Source:HGNC Symbol;Acc:19404]
Mouse Orthologue:
Noxo1
Mouse Description:
NADPH oxidase organizer 1 Gene [Source:MGI Symbol;Acc:MGI:1919143]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26180 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090370 Essential Splice Site 76 472 3 8
ENSDART00000129876 Essential Splice Site 74 383 3 10
Genomic Location (Zv9):
Chromosome 3 (position 62825404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61926509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCAAACCCCTTTAAGCGATCAGCACGGATTGTTCCCGAATTTAAAG[G/A]TAGAAAGTTTTTCTGTTGCTTTTTCTGTTGTTTTCTTTGAGTATTAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link