gemin4

Ensembl ID:
ENSDARG00000041252
ZFIN ID:
ZDB-GENE-050522-188
Description:
component of gems 4 [Source:RefSeq peptide;Acc:NP_001018154]
Human Orthologue:
GEMIN4
Human Description:
gem (nuclear organelle) associated protein 4 [Source:HGNC Symbol;Acc:15717]
Mouse Orthologue:
Gemin4
Mouse Description:
gem (nuclear organelle) associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:2449313]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1538 Nonsense F2 line generated During 2017
sa1290 Missense, Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1538
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060469 Nonsense 9 1057 2 2
ENSDART00000123167 Nonsense 9 770 2 3
Genomic Location (Zv9):
Chromosome 15 (position 23940469)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24651656
KASP Assay ID:
554-1461.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAATATACCTGATACCAGTCTTCTGTTTTAGAGTCATGGCTGAGCTG[T/A]GAGAAGACGGCTGTGCTACAGGGAGGATTCCTACTGGCCAGTCAGATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1290
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060469 Missense 734 1057 2 2
ENSDART00000123167 Nonsense 733 770 3 3
Genomic Location (Zv9):
Chromosome 15 (position 23938295)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24649482
KASP Assay ID:
554-1205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCCCATGCCCATGGAGACCAAAGAGCTGCTGTTGTCTGTACTCCACA[C/T]AATGGGAACAATCGTTGGAAAGGAAGTGGCTCGTGCACCTGATGTTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link