setdb1a

Ensembl ID:
ENSDARG00000041243
ZFIN ID:
ZDB-GENE-030131-2421
Description:
Histone-lysine N-methyltransferase SETDB1-A [Source:UniProtKB/Swiss-Prot;Acc:Q1L8U8]
Human Orthologue:
SETDB1
Human Description:
SET domain, bifurcated 1 [Source:HGNC Symbol;Acc:10761]
Mouse Orthologue:
Setdb1
Mouse Description:
SET domain, bifurcated 1 Gene [Source:MGI Symbol;Acc:MGI:1934229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1056 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1056
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060442 Essential Splice Site 1374 1442 19 21
ENSDART00000088336 Essential Splice Site 1368 1436 19 21
ENSDART00000144985   None 145 None 3
Genomic Location (Zv9):
Chromosome 19 (position 9763339)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9221878
KASP Assay ID:
554-0959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACATCATTGATGCTCGGCAAGAGGGAAACCTCGGCCGTTATATAAACG[T/A]AAGCAAAAGCCGGAATTGTTATCAAAATTGAACAATGCTTTAATGGTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link