med18

Ensembl ID:
ENSDARG00000041237
ZFIN ID:
ZDB-GENE-040426-1276
Description:
Mediator of RNA polymerase II transcription subunit 18 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3H7]
Human Orthologue:
MED18
Human Description:
mediator complex subunit 18 [Source:HGNC Symbol;Acc:25944]
Mouse Orthologue:
Med18
Mouse Description:
mediator of RNA polymerase II transcription, subunit 18 homolog (yeast) Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36037 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060447 Nonsense 21 208 1 2
Genomic Location (Zv9):
Chromosome 16 (position 8598347)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7461601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTTACTGTGATGCCCGTCACGGGTGGAACTATAAACATGATGGAGTA[T/A]CTTCTGCAAGGTAAACAACACCATCAGCACAACTCCTTTTACCATTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link