ENSDARG00000041221

Ensembl ID:
ENSDARG00000041221

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22822 Nonsense Mutation detected in F1 DNA During 2014
sa10762 Essential Splice Site Available for shipment Available now
sa10520 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060424 Nonsense 97 289 2 8
Genomic Location:
Chromosome 16 (position 24052183)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCTCTGACTGCTCTCTGAACATCAAGAAAGTCACAAAAGAAGATTAT[G/T]GATCTTACATCTGCCAACAATATGTGAATGGAGAACAATATGGACCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060424 Essential Splice Site 227 289 4 8
ENSDART00000060424 Essential Splice Site 227 289 4 8
Genomic Location:
Chromosome 16 (position 24053310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGTGTCAGTCATGAGCATGTRATYCTCTMGAAATTAGTTTATAAATAAA[C/A]TTTGATGATGAAGTATTMAAATATATTTKAATACTTCATCATCAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060424 Essential Splice Site 227 289 4 8
ENSDART00000060424 Essential Splice Site 227 289 4 8
Genomic Location:
Chromosome 16 (position 24053310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGTGTCAGTCATGAGCATGTRATYCTCTMGAAATTAGTTTATAAATAAA[C/A]TTTGATGATGAAGTATTMAAATATATTTKAATACTTCATCATCAAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lu3gkpbc