XPO6_DANRE

Ensembl ID:
ENSDARG00000041217
Description:
Exportin-6 [Source:UniProtKB/Swiss-Prot;Acc:Q8QHJ8]
Human Orthologue:
XPO6
Human Description:
exportin 6 [Source:HGNC Symbol;Acc:19733]
Mouse Orthologue:
Xpo6
Mouse Description:
exportin 6 Gene [Source:MGI Symbol;Acc:MGI:2429950]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19963 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109580 Essential Splice Site 628 1128 16 27
ENSDART00000138328 Essential Splice Site 568 1068 12 23
Genomic Location:
Chromosome 3 (position 14703520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTAGAGATGGCTGTTCCTTCAGTGCTTAAACCAGACCTTATAGACGT[G/A]TAAGTAGTTTGCTTTCACTTAACCTAGGAAAATGGATTGTTGTGTTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e9ox8wpt