XPO6_DANRE

Ensembl ID:
ENSDARG00000041217
Description:
Exportin-6 [Source:UniProtKB/Swiss-Prot;Acc:Q8QHJ8]
Human Orthologue:
XPO6
Human Description:
exportin 6 [Source:HGNC Symbol;Acc:19733]
Mouse Orthologue:
Xpo6
Mouse Description:
exportin 6 Gene [Source:MGI Symbol;Acc:MGI:2429950]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33113 Nonsense Mutation detected in F1 DNA During 2016
sa33112 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33111 Nonsense Mutation detected in F1 DNA During 2016
sa19963 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109580 Nonsense 422 1128 11 27
ENSDART00000138328 Nonsense 362 1068 7 23
Genomic Location (Zv9):
Chromosome 3 (position 14715688)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14961194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCAAACATCTGTATGTTTTTTTGTTGTAGCCGAGTCACGAAGGTTA[C/A]CTGGCCTGTCTTGACATCTGGAGTGTATTTCTGGACTACCTGACCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109580 Essential Splice Site 520 1128 13 27
ENSDART00000138328 Essential Splice Site 460 1068 9 23
Genomic Location (Zv9):
Chromosome 3 (position 14713738)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14959244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTGCCAGGGTGATGGAGCTGTTGCCGTCCCAGACCTTTTCAGTTCTG[G/T]TAGGTGTATATGAGTGGGCGAGCGTGCATGCAATCTCTCTCTCTTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109580 Nonsense 611 1128 16 27
ENSDART00000138328 Nonsense 551 1068 12 23
Genomic Location (Zv9):
Chromosome 3 (position 14703571)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14949077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCAGGCTGGTGGAAGTGTCGTGCTACGGTTCTCAGATCAGCCTGTA[T/A]GATGTAGAGATGGCTGTTCCTTCAGTGCTTAAACCAGACCTTATAGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109580 Essential Splice Site 628 1128 16 27
ENSDART00000138328 Essential Splice Site 568 1068 12 23
Genomic Location (Zv9):
Chromosome 3 (position 14703520)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14949026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTAGAGATGGCTGTTCCTTCAGTGCTTAAACCAGACCTTATAGACGT[G/A]TAAGTAGTTTGCTTTCACTTAACCTAGGAAAATGGATTGTTGTGTTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link