cetn2

Ensembl ID:
ENSDARG00000041215
ZFIN ID:
ZDB-GENE-030826-21
Description:
Centrin2 [Source:UniProtKB/TrEMBL;Acc:B1P0R9]
Mouse Orthologue:
Cetn4
Mouse Description:
centrin 4 Gene [Source:MGI Symbol;Acc:MGI:2677454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22405 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8585 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060417 Essential Splice Site 2 171 2 5
Genomic Location:
Chromosome 14 (position 1364089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCCTGGTGGAGACGTGTCTGAATCTCTCTTTTTGCTGTTATTTTCAA[G/C]GCGTCCGGCTTCAGGAAAAGCAGTGCTTCAGCAAACCAGAGGAAGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060417 Essential Splice Site 96 171 3 5
Genomic Location:
Chromosome 14 (position 1361393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCGTAATCGGCTTCAGCGATTTCCTTTCTATGAYGACACAGAAAATG[G/A]TGAGCAAACCAAACAATAACAGAACAATCTACAGTAAATCTGACCGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0iwhu6ss