cetn2

Ensembl ID:
ENSDARG00000041215
ZFIN ID:
ZDB-GENE-030826-21
Description:
Centrin2 [Source:UniProtKB/TrEMBL;Acc:B1P0R9]
Mouse Orthologue:
Cetn4
Mouse Description:
centrin 4 Gene [Source:MGI Symbol;Acc:MGI:2677454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22405 Essential Splice Site Available for shipment Available now
sa8585 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060417 Essential Splice Site 2 171 2 5
Genomic Location (Zv9):
Chromosome 14 (position 1364089)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1340663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCCTGGTGGAGACGTGTCTGAATCTCTCTTTTTGCTGTTATTTTCAA[G/C]GCGTCCGGCTTCAGGAAAAGCAGTGCTTCAGCAAACCAGAGGAAGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060417 Essential Splice Site 96 171 3 5
Genomic Location (Zv9):
Chromosome 14 (position 1361393)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1337967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCGTAATCGGCTTCAGCGATTTCCTTTCTATGAYGACACAGAAAATG[G/A]TGAGCAAACCAAACAATAACAGAACAATCTACAGTAAATCTGACCGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link