si:dkey-164m14.1

Ensembl ID:
ENSDARG00000041205
ZFIN ID:
ZDB-GENE-041210-296
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:Q5RFU9]
Human Orthologue:
SLC6A1
Human Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 [Source:HGNC Symbol;Acc:11042
Mouse Orthologue:
Slc6a1
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26312 Nonsense Mutation detected in F1 DNA During 2017
sa31401 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011519 Nonsense 211 578 5 14
ENSDART00000138830 Nonsense 105 445 3 11
Genomic Location (Zv9):
Chromosome 4 (position 26315900)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27025035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCCATTGGTTGGAACTTTGGCATTGTCCTGGATTCTTGTCTATTTCT[C/A]AATCTGGAAAGGGGTGGAGTGGACAGGAAAGGTATGCATGCCAACATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011519 Nonsense 428 578 11 14
ENSDART00000138830 Nonsense 324 445 9 11
Genomic Location (Zv9):
Chromosome 4 (position 26363421)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27077742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTGAGACTGATTGTGTTTTTGTTGTTGTTTTTTTAGGGTGGCTTATA[T/A]GTGTTTAAACTGTTCGACTACTACTCAGCCAGTGGAATGTGTCTTCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link