hdac4

Ensembl ID:
ENSDARG00000041204
ZFIN ID:
ZDB-GENE-061013-95
Description:
histone deacetylase 4 [Source:RefSeq peptide;Acc:NP_001034447]
Human Orthologue:
HDAC4
Human Description:
histone deacetylase 4 [Source:HGNC Symbol;Acc:14063]
Mouse Orthologue:
Hdac4
Mouse Description:
histone deacetylase 4 Gene [Source:MGI Symbol;Acc:MGI:3036234]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25438 Nonsense Mutation detected in F1 DNA During 2014
sa3746 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14812 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036277 Nonsense 52 1023 2 25
ENSDART00000124870 Nonsense 52 1023 2 25
ENSDART00000127567 Nonsense 52 1026 1 25
ENSDART00000135537 None None 850 None 21

The following transcripts of ENSDARG00000041204 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 47107732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCGTGAGCATCAGCTGCAGCAGGAGCTTCTGGCCCTCAAGCAGAAA[C/T]AGCAGATCCAGAGGCAGCTCCTGATCGAAGAGTTTCAGCGGCAGCACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036277 Essential Splice Site 333 1023 8 25
ENSDART00000124870 Essential Splice Site 333 1023 8 25
ENSDART00000127567 Essential Splice Site 335 1026 7 25
ENSDART00000135537 Essential Splice Site 160 850 4 21

The following transcripts of ENSDARG00000041204 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 47062259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCTTCCMAACATCACCCTGGGTCTGCCAGCCACCGGCCCYTCCAGCG[T/C]GAGTCTATCCTTCCTTCCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036277 Essential Splice Site 537 1023 11 25
ENSDART00000124870 Essential Splice Site 537 1023 11 25
ENSDART00000127567 Essential Splice Site 539 1026 10 25
ENSDART00000135537 Essential Splice Site 364 850 7 21

The following transcripts of ENSDARG00000041204 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 47043976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTCAGCAGAGAGAGAGRCAAGCGGAGGAGGAGCTGCTCTTCAGACAG[G/A]TGAAACTCTATTTGCATTACACACACACAAGCACACACCAGTCAAATRAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/keoxxu82