alg12

Ensembl ID:
ENSDARG00000041199
ZFIN ID:
ZDB-GENE-041210-295
Description:
dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichyl-alpha-1, 6-mannosyltransferase [Source:RefSeq peptide;Ac
Human Orthologue:
ALG12
Human Description:
asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Alg12
Mouse Description:
asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase) Gene [Source:MGI S

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45179 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115200 Nonsense 349 493 7 9

The following transcripts of ENSDARG00000041199 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 26405170)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27119491
GRCz11 4 27108779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATTACCAAAAGTCACGGATATATAAAATTGGTTCCATAGTTGTGGTT[G/T]GACATTTGATGTTAAATGCAACATACACAAGCATTTCTCTGTATGTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link