crfb7

Ensembl ID:
ENSDARG00000041180
ZFIN ID:
ZDB-GENE-070905-4
Description:
cytokine receptor family member b7 [Source:RefSeq peptide;Acc:NP_001071093]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13325 Essential Splice Site Available for shipment Available now
sa1054 Essential Splice Site F2 line generated During 2014
sa4593 Nonsense Mutation detected in F1 DNA During 2014
sa14148 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Essential Splice Site 165 536 4 7
Genomic Location:
Chromosome 15 (position 13082234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACTAAGTTACTCTGCCATTCTGTWTCCRAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1054
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Essential Splice Site 165 536 4 7
Genomic Location:
Chromosome 15 (position 13082234)
KASP Assay ID:
554-0957.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACTAAGTTACTCTGCCATTCTGTATCCAAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Nonsense 268 536 7 7
Genomic Location:
Chromosome 15 (position 13076534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTCATCAGAAATTGGCTGTGAATGGCTGGCTCCCAATGAATGTAGGA[C/T]AAACCGAGGTGGAATCGGTCACTCAGAAGGGATGGCTACTGAACAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Nonsense 435 536 7 7
Genomic Location:
Chromosome 15 (position 13076033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTCAATGTGATGAAGACGCTAATATGGTTAGTCGCAYCAATGGCTAT[C/T]GATCTGGTCAAGTCACATGCTTGTGTTCTGACTCCGAAACTTGCATGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yjznmymc