scn2b

Ensembl ID:
ENSDARG00000041176
ZFIN IDs:
ZDB-GENE-070920-1, ZDB-GENE-070920-1
Description:
sodium channel subunit beta-2 [Source:RefSeq peptide;Acc:NP_001071097]
Human Orthologue:
SCN2B
Human Description:
sodium channel, voltage-gated, type II, beta [Source:HGNC Symbol;Acc:10589]
Mouse Orthologue:
Scn2b
Mouse Description:
sodium channel, voltage-gated, type II, beta Gene [Source:MGI Symbol;Acc:MGI:106921]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32016 Essential Splice Site Available for shipment Available now
sa39036 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101293 Essential Splice Site 28 223 1 6
ENSDART00000101294 Essential Splice Site 28 230 1 5
Genomic Location (Zv9):
Chromosome 15 (position 12916795)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12614022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCGTCCGCTTTGAAATTATCCTGTGTTGCAATGGTGATGTTTCTGGG[T/C]AAGTAAAAAAAGAGCTTCTGCTATGGGGGGAATAAATGAAGCACATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101293 Essential Splice Site 221 223 4 6
ENSDART00000101294 Essential Splice Site 221 230 4 5
Genomic Location (Zv9):
Chromosome 15 (position 12936607)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12594210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAGGGCAAAGTAGATGGTGAAGGAGGCACAGAAGAAGCAACAAA[G/T]TAAGAATTTCTGTCTTTTATTTTCTCCCTTTGCCAGTATTTTAGTGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link