si:dkey-193n17.7

Ensembl ID:
ENSDARG00000041164
ZFIN ID:
ZDB-GENE-070912-420
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7631 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060337 Missense 62 175 1 1
Genomic Location (Zv9):
Chromosome 9 (position 28404980)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27560676
KASP Assay ID:
554-4261.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCTTCCAAACYTAGARCAGCGTGGRCCTCCATTTCTGCGTCTCTGTC[T/A]GCACAGTCGAGACTTTCAGYTGGGACACGACATTGTGGAAAACATCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link