LOC100150246

Ensembl ID:
ENSDARG00000041162
Human Orthologue:
GRM1
Human Description:
glutamate receptor, metabotropic 1 [Source:HGNC Symbol;Acc:4593]
Mouse Orthologue:
Grm1
Mouse Description:
glutamate receptor, metabotropic 1 Gene [Source:MGI Symbol;Acc:MGI:1351338]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36312 Nonsense Mutation detected in F1 DNA During 2016
sa16519 Nonsense Available for shipment Available now
sa22996 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048546 Nonsense 570 1159 6 8
Genomic Location:
Chromosome 17 (position 7238019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGAATATGTCCAGGATGAGTTTACCTGCAAAGCCTGTGAATTGGGAT[G/A]GTGGCCGGATGAAGAGCTGCAAGGTAATTTATCGACATTAGCCACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048546 Nonsense 1029 1159 8 8
Genomic Location:
Chromosome 17 (position 7223167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCACTTTCAGGATGATGTAGTCAAGTWTAATTCAAACRTGGCCGATT[T/A]GGATGAAATCATAAGCCTTCCTGAACCWACCGATGGCATCATTTTGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048546 Nonsense 1062 1159 8 8
Genomic Location:
Chromosome 17 (position 7223067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGCCTCAAGTTTTGCATCCTCATCCGATTTTACCCATGAACGTTTA[T/A]CAGGATGAACCATCTTCTCCTTTGGAGGAGGTGGAAAACGAACAATTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link