LOC100150246

Ensembl ID:
ENSDARG00000041162
Human Orthologue:
GRM1
Human Description:
glutamate receptor, metabotropic 1 [Source:HGNC Symbol;Acc:4593]
Mouse Orthologue:
Grm1
Mouse Description:
glutamate receptor, metabotropic 1 Gene [Source:MGI Symbol;Acc:MGI:1351338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16519 Nonsense Available for shipment Available now
sa22996 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048546 Nonsense 1029 1159 8 8
Genomic Location:
Chromosome 17 (position 7223167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCACTTTCAGGATGATGTAGTCAAGTWTAATTCAAACRTGGCCGATT[T/A]GGATGAAATCATAAGCCTTCCTGAACCWACCGATGGCATCATTTTGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048546 Nonsense 1062 1159 8 8
Genomic Location:
Chromosome 17 (position 7223067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGCCTCAAGTTTTGCATCCTCATCCGATTTTACCCATGAACGTTTA[T/A]CAGGATGAACCATCTTCTCCTTTGGAGGAGGTGGAAAACGAACAATTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/behsjl32