rcan1

Ensembl ID:
ENSDARG00000041157
ZFIN ID:
ZDB-GENE-030131-8292
Description:
Rcan1 protein [Source:UniProtKB/TrEMBL;Acc:Q6DGB1]
Human Orthologue:
RCAN1
Human Description:
regulator of calcineurin 1 [Source:HGNC Symbol;Acc:3040]
Mouse Orthologue:
Rcan1
Mouse Description:
regulator of calcineurin 1 Gene [Source:MGI Symbol;Acc:MGI:1890564]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2014 Nonsense Mutation detected in F1 DNA During 2014
sa1725 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060324 Nonsense 94 171 3 5
ENSDART00000123271 Nonsense 120 215 3 4
Genomic Location:
Chromosome 1 (position 2696345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTTCCTGATTTCTCCTCCAGCGTCGCCCCCTGTTGGCTGGGCGCAGT[C/A]GCAGGACGCAATGCCCGTCATCAACTATGACCTGTTGTGTGCCGTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060324 Missense 170 171 5 5
ENSDART00000123271 Nonsense 197 215 4 4
Genomic Location:
Chromosome 1 (position 2702626)
KASP Assay ID:
554-1671.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGGCCCAAAATCATCCAGACACGCCGCCCAGATTTCGTCCCGTCGGTG[G/A]ACCAGTGAGCATTTCCTGACCCGTTCATCTCCGCGACCCAAACCGGGGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tbs1uup2