morf4l1

Ensembl ID:
ENSDARG00000041155
ZFIN ID:
ZDB-GENE-040718-348
Description:
mortality factor 4-like protein 1 [Source:RefSeq peptide;Acc:NP_001002604]
Human Orthologues:
MORF4L1, MORF4L2
Human Descriptions:
mortality factor 4 like 1 [Source:HGNC Symbol;Acc:16989]
mortality factor 4 like 2 [Source:HGNC Symbol;Acc:16849]
Mouse Orthologues:
Morf4l1, Morf4l2
Mouse Descriptions:
mortality factor 4 like 1 Gene [Source:MGI Symbol;Acc:MGI:1096551]
mortality factor 4 like 2 Gene [Source:MGI Symbol;Acc:MGI:1927167]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25062 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060319 None None 195 2 12
ENSDART00000139441 Nonsense 16 323 2 12
Genomic Location:
Chromosome 18 (position 19815866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGTGGATGTCATTGTATATTAATATTTCTGATGTTTTTTCAGGTGAA[C/T]GAGTGCTGTGCTTTCATGGGCCATTGCTATACGAAGCTAAGGTACCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0drl42l1