paqr5a

Ensembl ID:
ENSDARG00000041145
ZFIN ID:
ZDB-GENE-040426-867
Description:
Membrane progestin receptor gamma-A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVH1]
Human Orthologue:
PAQR6
Human Description:
progestin and adipoQ receptor family member VI [Source:HGNC Symbol;Acc:30132]
Mouse Orthologues:
Gm6821, Paqr6
Mouse Descriptions:
predicted gene 6821 Gene [Source:MGI Symbol;Acc:MGI:3779634]
progestin and adipoQ receptor family member VI Gene [Source:MGI Symbol;Acc:MGI:1916207]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29024 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36635 Nonsense Mutation detected in F1 DNA During 2017
sa30704 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060311 Essential Splice Site 61 345 3 9
Genomic Location (Zv9):
Chromosome 18 (position 20244548)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20474771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAACAAATGAAACCCTCAATATTTGGACTCATTTTCTACCTACATGG[T/A]AAGTTCTTTTTCGAGATATTTTTTTAAATATGGCCACATTTAGTTAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060311 Nonsense 153 345 5 9
Genomic Location (Zv9):
Chromosome 18 (position 20243190)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20473413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTCGTTTCCAGATAAATGGGTTAATGGCACATTTCACTTAAACTA[T/A]GTTTCTATAGCTGTTGTCAACTCTATTATCTCCACTGCTCTTGCCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060311 Essential Splice Site 187 345 6 9
Genomic Location (Zv9):
Chromosome 18 (position 20242966)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20473189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGACTTGGTTTACCATTTCTTGAGTATAATTGCCACAGCATTAAAAG[G/T]TATTTATTGTTTTGCATTTTAATCTTGATTGTAAAAATAATGTTCAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link