ddb2

Ensembl ID:
ENSDARG00000041140
ZFIN ID:
ZDB-GENE-050419-169
Description:
DNA damage-binding protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDS1]
Human Orthologue:
DDB2
Human Description:
damage-specific DNA binding protein 2, 48kDa [Source:HGNC Symbol;Acc:2718]
Mouse Orthologue:
Ddb2
Mouse Description:
damage specific DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1355314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18412 Nonsense Available for shipment Available now
sa2975 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa18412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060302 Nonsense 82 496 3 11
ENSDART00000100665 Nonsense 82 497 3 11
ENSDART00000147867 Nonsense 82 490 3 11
Genomic Location (Zv9):
Chromosome 18 (position 20249491)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20479714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGGCCAAAYAAGCATTCTTCATTACATTTACAAAAGTTCATTGGGA[C/T]AGAGTATCCATGCTCAACTGCGCCAGGTAATGACAATTGAAGTTTGGGGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2975
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060302 Nonsense 280 496 7 11
ENSDART00000100665 Nonsense 287 497 7 11
ENSDART00000147867 Nonsense 280 490 7 11
Genomic Location (Zv9):
Chromosome 18 (position 20256344)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20486567
KASP Assay ID:
554-3173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGTTGATGCTACAGTCAAGCTGTGGGACCTCCGGAATATTAAAGAC[A/T]AAAACAGTTACATCGCTGAGATGCCTCATGAAAAACCAGTCAATGCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link