dhrs13

Ensembl ID:
ENSDARG00000041137
ZFIN ID:
ZDB-GENE-041114-134
Description:
dehydrogenase/reductase (SDR family) member 13 [Source:RefSeq peptide;Acc:NP_001007425]
Human Orthologue:
DHRS13
Human Description:
dehydrogenase/reductase (SDR family) member 13 [Source:HGNC Symbol;Acc:28326]
Mouse Orthologue:
Dhrs13
Mouse Description:
dehydrogenase/reductase (SDR family) member 13 Gene [Source:MGI Symbol;Acc:MGI:1917701]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11493 Nonsense Available for shipment Available now
sa17623 Essential Splice Site Available for shipment Available now
sa28467 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2793 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060304 Nonsense 17 318 1 5
Genomic Location (Zv9):
Chromosome 15 (position 27434213)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28152453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCTGTCCTGTTGTCAGTGTTGGTCGGWGTGCTTGCTGCCTACGTAT[T/A]RATTTATTATTGCTTGTTTAAAGGAGCCAGATATAAGGGGAACGCGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060304 Essential Splice Site 42 318 1 5
Genomic Location (Zv9):
Chromosome 15 (position 27434135)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28152375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATATAAGGGGAACGCGACGTTAAATGGGAAAACAGCAATCGTTACAG[G/A]YTGGTAACCTATTAAAACGCATCACAATGTTTGTTAASTTGCATACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060304 Essential Splice Site 43 318 1 5
Genomic Location (Zv9):
Chromosome 15 (position 27434134)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28152374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATATAAGGGGAACGCGACGTTAAATGGGAAAACAGCAATCGTTACAGG[T/C]TGGTAACCTATTAAAACGCATCACAATGTTTGTTAAGTTGCATACATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060304 Essential Splice Site 43 318 2 5
Genomic Location (Zv9):
Chromosome 15 (position 27433698)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28151938
KASP Assay ID:
554-2730.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAGTTTGTTTGTGGTGTCTCATTACTGTTTATCAATAATCTGAATGC[A/T]GGTAGTAATACAGGCATTGGCAAAACCACTGCTTTGGATCTTGCCAGARG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link