rapsn

Ensembl ID:
ENSDARG00000041133
ZFIN ID:
ZDB-GENE-030313-1
Description:
43 kDa receptor-associated protein of the synapse [Source:RefSeq peptide;Acc:NP_840090]
Human Orthologue:
RAPSN
Human Description:
receptor-associated protein of the synapse [Source:HGNC Symbol;Acc:9863]
Mouse Orthologue:
Rapsn
Mouse Description:
receptor-associated protein of the synapse Gene [Source:MGI Symbol;Acc:MGI:99422]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6513 Nonsense Confirmed mutation in F2 line During 2014
sa985 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6513
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060295 Nonsense 33 412 1 8
ENSDART00000127110 Nonsense 44 423 1 8
Genomic Location:
Chromosome 18 (position 20275293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACCAGTCTAATGACACAGAAAAGGCTTTATATGTTTGGATGAAAGTGT[T/A]AAGGAAGACATCTGATCCTGGGGGGAAGTTTCGGGTTTTGGGRTGTCTGA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
trunk
ZFA:0001115
curved
PATO:0000406
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060295 Essential Splice Site 304 412 5 8
ENSDART00000127110 Essential Splice Site 315 423 5 8
Genomic Location:
Chromosome 18 (position 20289900)
KASP Assay ID:
554-0889.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGTAGGAGTGGGGAAGTGCTGGATTCTGCAGAAGGAATATGATAAGG[T/G]CAAGATTTAATTGTGTCTTTTAGATAACGTGTGAAYATTTGTGATCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7hp1593a