dnajc3

Ensembl ID:
ENSDARG00000041110
ZFIN ID:
ZDB-GENE-030131-1264
Description:
dnaJ homolog subfamily C member 3 [Source:RefSeq peptide;Acc:NP_955904]
Human Orthologue:
DNAJC3
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 [Source:HGNC Symbol;Acc:9439]
Mouse Orthologue:
Dnajc3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 Gene [Source:MGI Symbol;Acc:MGI:107373]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16813 Nonsense Available for shipment Available now
sa34665 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060246 Nonsense 291 504 8 12

The following transcripts of ENSDARG00000041110 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30523363)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29679309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTTTGTTTTYGTAAATGCACAGGTACAGTGATGCAGTCAGTAAATA[C/A]GAGTCTGTTATGAAGACTGAACCGAATGTTCCCCACTTCACACTGAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060246 Nonsense 484 504 12 12

The following transcripts of ENSDARG00000041110 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30517710)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29673656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAGTCAGCAGGGTGGAGGACATCACCACCACTTCCATGGCGGCTGG[G/T]AAAACTTCCAGGGGTTCAATCCGTTTGGTTCTGGACCTTTTAATTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link