ctsh

Ensembl ID:
ENSDARG00000041108
ZFIN ID:
ZDB-GENE-030131-3539
Description:
cathepsin H [Source:RefSeq peptide;Acc:NP_997853]
Human Orthologue:
CTSH
Human Description:
cathepsin H [Source:HGNC Symbol;Acc:2535]
Mouse Orthologue:
Ctsh
Mouse Description:
cathepsin H Gene [Source:MGI Symbol;Acc:MGI:107285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa665 Nonsense F2 line generated During 2016
sa36656 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa665
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060245 Nonsense 41 330 3 12

The following transcripts of ENSDARG00000041108 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26209213)
KASP Assay ID:
554-0573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTCTAACTCCANNNTTTCTTTTCAAATTTGCAGTACAATAAAAAATA[T/A]GAGATAAATGAATTTTACCAGCGGCTSCAGATATTCCTGGAGAACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060245 Essential Splice Site 228 330 None 12

The following transcripts of ENSDARG00000041108 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 26211891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAATTGGCTGCAGCTTTTGTGAAGGAAGTTGTAAACATCACAAAGG[T/A]AATTGATGGCGCATCTACAAGTATTAAACATTTGGTATGTCTGATTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link