cftr

Ensembl ID:
ENSDARG00000041107
ZFIN ID:
ZDB-GENE-050517-20
Description:
cystic fibrosis transmembrane conductance regulator [Source:RefSeq peptide;Acc:NP_001038348]
Human Orthologue:
CFTR
Human Description:
cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) [S
Mouse Orthologue:
Cftr
Mouse Description:
cystic fibrosis transmembrane conductance regulator homolog Gene [Source:MGI Symbol;Acc:MGI:88388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39198 Nonsense Mutation detected in F1 DNA During 2016
sa23289 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060243 Nonsense 932 1485 17 27
Genomic Location (Zv9):
Chromosome 18 (position 20483650)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20713873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCCCACAAGCAGCTATTACATTCTCTACATATATGTGGCCACGTCA[G/T]AGAGCCTCCTCGCGATGGGATTTTTCAGAGGTCTTCCGTTTGTACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060243 Nonsense 1220 1485 22 27
Genomic Location (Zv9):
Chromosome 18 (position 20494954)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20725177
KASP Assay ID:
2261-2124.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGCCACACCGCGGTCAGATCGAAGTGAGGAATTTAACAGTCAAATA[C/A]ACAGAAGCGGGTCACGCTGTCCTCAAAAACCTGTCCTTCAGTGCGGAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link