RERG

Ensembl ID:
ENSDARG00000041104
Description:
RAS-like, estrogen-regulated, growth inhibitor [Source:HGNC Symbol;Acc:15980]
Human Orthologue:
RERG
Human Description:
RAS-like, estrogen-regulated, growth inhibitor [Source:HGNC Symbol;Acc:15980]
Mouse Orthologue:
Rerg
Mouse Description:
RAS-like, estrogen-regulated, growth-inhibitor Gene [Source:MGI Symbol;Acc:MGI:2665139]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36919 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060236 Essential Splice Site 65 203 4 4
Genomic Location (Zv9):
Chromosome 19 (position 46816503)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTTTTGATTTGGGAACTGAGGAGATGTCCATCTGTGTGTCTCCGGC[A/T]GGAGGATGTCCTGCAGAGGGAGAGCCACATGCGCTGGGGCGACGGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link