PITPNM2

Ensembl ID:
ENSDARG00000041100
Description:
phosphatidylinositol transfer protein, membrane-associated 2 [Source:HGNC Symbol;Acc:21044]
Human Orthologue:
PITPNM2
Human Description:
phosphatidylinositol transfer protein, membrane-associated 2 [Source:HGNC Symbol;Acc:21044]
Mouse Orthologue:
Pitpnm2
Mouse Description:
phosphatidylinositol transfer protein, membrane-associated 2 Gene [Source:MGI Symbol;Acc:MGI:1336192

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38815 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6138 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7288 Nonsense Mutation detected in F1 DNA During 2017
sa9834 Nonsense Available for shipment Available now
sa41742 Nonsense Mutation detected in F1 DNA During 2017
sa7289 Nonsense Mutation detected in F1 DNA During 2017
sa17312 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Essential Splice Site 27 1285 2 32
Genomic Location (Zv9):
Chromosome 10 (position 46421877)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 11751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATGCATTATAAAGAAGCTGTGTGTGTGTGTGTGTGTGTGTGTCCATC[T/A]GCAGAAGAAGAGTCGTGAGGAGAGCGAGGGCGAGGGCAGCGGTGTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Essential Splice Site 552 1285 13 32
Genomic Location (Zv9):
Chromosome 10 (position 46437860)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 27734
KASP Assay ID:
554-3657.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCAYCACCTTCCTGCACGATGGTGMCATSAGAAATGAAGTCAAACAG[G/A]TGRGCAATGAGTGAAGCTGCTGCTGCTGCNNNTCTGCATATTAACCGCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Nonsense 558 1285 14 32
Genomic Location (Zv9):
Chromosome 10 (position 46440385)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 30259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCGCTGTTTCCATCRCAGKTYATGCRCATCTCWGCGTTTCCATCAAT[C/T]GATTTTCATRTTGTGTGTGTTGGAGACAAAAAATACCCACACACTTRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Nonsense 579 1285 14 32
Genomic Location (Zv9):
Chromosome 10 (position 46440450)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 30324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTTGGAGACAAAAAATACCCACACACTTRCAGATTTGCTCTGAGTA[C/A]AGATTCACTGATACACACTTYACAACCACACAKGACACTTCTACAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Nonsense 597 1285 14 32
Genomic Location (Zv9):
Chromosome 10 (position 46440504)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 30378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTGATACACACTTTACAACCACACATGACACTTCTACAGCTGCTTG[G/A]GAGTTTTGCACCAAAAAGACCTTCATAAGTGTGTAACACCTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Nonsense 877 1285 22 32
Genomic Location (Zv9):
Chromosome 10 (position 46445195)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 35069
KASP Assay ID:
554-5138.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGCAGCTTCACGTCTCGTTGTCAGATCAGTGTGTGAGCCGCWGGAGY[T/A]GACGGCGTCCCSCTMCTGTAGAGCTAACGTTACCCTAATTACCCYAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060194 Essential Splice Site 886 1285 22 32
Genomic Location (Zv9):
Chromosome 10 (position 46445223)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150191.1 35097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTGTGAGCCGCTGGAGYTGACGGCGTCCCSCTMCTGTAGAGCTAA[C/A]GTYACCCTAATTACCCYAGTGAAGCCTTACATGTCTGAACACTGGTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link