barx2

Ensembl ID:
ENSDARG00000041098
ZFIN IDs:
ZDB-GENE-081104-285, ZDB-GENE-081120-4, ZDB-GENE-081120-4
Description:
Novel protein similar to vertebrate BARX homeobox 2 (BARX2) [Source:UniProtKB/TrEMBL;Acc:B8JMG1]
Human Orthologue:
BARX2
Human Description:
BARX homeobox 2 [Source:HGNC Symbol;Acc:956]
Mouse Orthologue:
Barx2
Mouse Description:
BarH-like homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:109617]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23384 Nonsense Mutation detected in F1 DNA During 2014
sa11113 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060219 Nonsense 202 268 4 4
ENSDART00000138806 None None 148 None 2
Genomic Location:
Chromosome 18 (position 45789969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAACCAAACCTAAAGGCCGACCCAAGAAGAACTCAATCCCAACCACT[G/T]AGGAGATCGAGGCCCAGGAGCGAATGGAGGCCAAACTGGCAGAGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060219 Nonsense 254 268 4 4
ENSDART00000138806 None None 148 None 2
Genomic Location:
Chromosome 18 (position 45790125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACATCCGCCACATCYGCCGTCGAGTATGTCTGTCCAGAAAGCCCAGAG[C/T]GAGAGCAGGCACCGGCATCACCGTCAGAAGCAATGACYACCAGCTAAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Genome-wide association study in east Asians identifies novel susceptibility loci for breast cancer. (View Study)
  • Type 2 diabetes: A genome-wide association search for type 2 diabetes genes in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hb1cp33k