barx2

Ensembl ID:
ENSDARG00000041098
ZFIN IDs:
ZDB-GENE-081104-285, ZDB-GENE-081120-4, ZDB-GENE-081120-4
Description:
Novel protein similar to vertebrate BARX homeobox 2 (BARX2) [Source:UniProtKB/TrEMBL;Acc:B8JMG1]
Human Orthologue:
BARX2
Human Description:
BARX homeobox 2 [Source:HGNC Symbol;Acc:956]
Mouse Orthologue:
Barx2
Mouse Description:
BarH-like homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:109617]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36732 Nonsense Mutation detected in F1 DNA During 2016
sa23384 Nonsense Mutation detected in F1 DNA During 2016
sa11113 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060219 Nonsense 166 268 3 4
ENSDART00000138806   None 148 None 2
Genomic Location (Zv9):
Chromosome 18 (position 45787097)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47344785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATCTGGCTCAGTCACTGGGACTCACACAGCTCCAGGTGAAGACGTG[G/A]TACCAGAACCGACGCATGAAATGGAAGAAAATGGTGAGTCCAACAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060219 Nonsense 202 268 4 4
ENSDART00000138806   None 148 None 2
Genomic Location (Zv9):
Chromosome 18 (position 45789969)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47347657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAACCAAACCTAAAGGCCGACCCAAGAAGAACTCAATCCCAACCACT[G/T]AGGAGATCGAGGCCCAGGAGCGAATGGAGGCCAAACTGGCAGAGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060219 Nonsense 254 268 4 4
ENSDART00000138806   None 148 None 2
Genomic Location (Zv9):
Chromosome 18 (position 45790125)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47347813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACATCCGCCACATCYGCCGTCGAGTATGTCTGTCCAGAAAGCCCAGAG[C/T]GAGAGCAGGCACCGGCATCACCGTCAGAAGCAATGACYACCAGCTAAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Genome-wide association study in east Asians identifies novel susceptibility loci for breast cancer. (View Study)
  • Type 2 diabetes: A genome-wide association search for type 2 diabetes genes in African Americans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link