tufm

Ensembl ID:
ENSDARG00000041088
ZFIN ID:
ZDB-GENE-050320-73
Description:
elongation factor Tu, mitochondrial [Source:RefSeq peptide;Acc:NP_001013523]
Human Orthologue:
TUFM
Human Description:
Tu translation elongation factor, mitochondrial [Source:HGNC Symbol;Acc:12420]
Mouse Orthologues:
Gm9755, Tufm
Mouse Descriptions:
predicted pseudogene 9755 Pseudogene [Source:MGI Symbol;Acc:MGI:3642279]
Tu translation elongation factor, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1923686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5178 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060205 Nonsense 352 448 9 10
Genomic Location:
Chromosome 3 (position 113410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGATGGTCTTTTTCTTTATTTTTTTAATGTGTGTNNGTGTNNTCAGGTCTA[C/A]ATTCTGAGTAAAGAAGAGGGCGGCAGACACAAGCCGTTCTTCACTAACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tghjnub2