si:ch211-200o3.4

Ensembl ID:
ENSDARG00000041083
ZFIN ID:
ZDB-GENE-030131-4781
Description:
membrane alanine aminiopeptidase [Source:RefSeq peptide;Acc:NP_001038326]
Human Orthologue:
ANPEP
Human Description:
alanyl (membrane) aminopeptidase [Source:HGNC Symbol;Acc:500]
Mouse Orthologue:
Anpep
Mouse Description:
alanyl (membrane) aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:96749]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12011 Nonsense Available for shipment Available now
sa23292 Essential Splice Site Available for shipment Available now
sa43096 Nonsense Mutation detected in F1 DNA During 2017
sa12973 Nonsense Available for shipment Available now
sa23291 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 142 946 1 20
Genomic Location (Zv9):
Chromosome 18 (position 20877951)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21108174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGTGAGAAAATCGGATACCAATGAGAAATTGCCATTGAAGGGATAT[C/T]AAATYTTCAAGAACGAAACTAATTTCCTTGACATCCATCTTGAGGTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Essential Splice Site 295 946 3 20
Genomic Location (Zv9):
Chromosome 18 (position 20875995)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21106218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACATACATTCTCATATGTATCTAAAGGAACCCGGACAAAAATACATG[T/A]AGGTTGAGTGCCTGCTTATTTATTACAATTTTAATCATTTCACATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 299 946 4 20
Genomic Location (Zv9):
Chromosome 18 (position 20875915)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21106138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATCATTTCACATCTAATCATTATTATGTGTTTCTAAGGTACATGGT[C/T]GATCAGAGGCTATTGATGCTGGCCATGCTGACTACGCACTGGAAACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 595 946 12 20
Genomic Location (Zv9):
Chromosome 18 (position 20868603)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21098826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGAGTAACCCAGCAACTGYTTTCTTACAGATCCAATTCCAGATTTC[A/T]AAATTGGCAAAGATAACTGGCTTCTTGCCAACWTCAACTGCACAGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Essential Splice Site 702 946 15 20
Genomic Location (Zv9):
Chromosome 18 (position 20865449)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21095672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACACACCAAAAACACCATAAAAGCTTTAACTTTACATTTCTATGTTT[A/T]GAAATACCTACGAAACTTGGTCACACCATTATATGAGGAATATGAGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link