chka

Ensembl ID:
ENSDARG00000041078
ZFIN ID:
ZDB-GENE-050208-149
Description:
choline kinase alpha [Source:RefSeq peptide;Acc:NP_001038330]
Human Orthologue:
CHKA
Human Description:
choline kinase alpha [Source:HGNC Symbol;Acc:1937]
Mouse Orthologue:
Chka
Mouse Description:
choline kinase alpha Gene [Source:MGI Symbol;Acc:MGI:107760]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43097 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060015 Nonsense 223 400 5 11
ENSDART00000060184 Nonsense 241 418 6 12
Genomic Location (Zv9):
Chromosome 18 (position 20917174)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21147397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCACCAGGGAACCTCATCTGCGAAACTTCTCTCGCATTTTGAGCTA[C/A]AACTTGCCTCAAGAGATGGACAATCTCAAGTAAATCTTTAAAATATTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link