si:dkey-12e7.4

Ensembl ID:
ENSDARG00000041073
ZFIN ID:
ZDB-GENE-050419-83
Description:
hypothetical protein LOC558132 [Source:RefSeq peptide;Acc:NP_001137514]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23294 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060175 Essential Splice Site 49 256 1 6
Genomic Location (Zv9):
Chromosome 18 (position 20958174)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21188397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCCGGGAAGATTATCGCCACTGCGCGGAATCCAAATGGAGCCAAGG[T/C]AAAGCTCAGAGCAGACAGTGTAGTATTTACATTAGGTCTGTTGTACAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link