mier1a

Ensembl ID:
ENSDARG00000041072
ZFIN ID:
ZDB-GENE-030131-409
Description:
mesoderm induction early response 1 homolog a [Source:RefSeq peptide;Acc:NP_955853]
Human Orthologue:
MIER1
Human Description:
mesoderm induction early response 1 homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:29657]
Mouse Orthologue:
Mier1
Mouse Description:
mesoderm induction early response 1 homolog (Xenopus laevis Gene [Source:MGI Symbol;Acc:MGI:1918398]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31523 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060169 Splice Site, Nonsense 242 469 8 13

The following transcripts of ENSDARG00000041072 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 34992666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34848862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGGTGTCGACGCCATTCCTGAAGGATCTCACATCAAAGACAATGAA[C/T]AGGCAGGTCTCCATCCCATGGGATATTTACCTTAATCATACTGATTCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link