jagn1a

Ensembl ID:
ENSDARG00000041071
ZFIN ID:
ZDB-GENE-041010-80
Description:
Protein jagunal homolog 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q5XJX0]
Human Orthologue:
JAGN1
Human Description:
jagunal homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:26926]
Mouse Orthologue:
Jagn1
Mouse Description:
jagunal homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915017]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25427 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060174 Nonsense 131 183 3 3
Genomic Location (Zv9):
Chromosome 9 (position 31143732)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30299678
KASP Assay ID:
554-7464.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGATTTTTGGTGCGATGGAAATGTTTCCTCTGGCCCAGCAGCTGTAC[C/T]GACATGGAAAAGCCTACAGGTTTATCTTCGGCTTCTCGGCTGTTTCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link