calb2a

Ensembl ID:
ENSDARG00000041062
ZFIN ID:
ZDB-GENE-040426-1677
Description:
calbindin 2a [Source:RefSeq peptide;Acc:NP_957012]
Human Orthologue:
CALB2
Human Description:
calbindin 2 [Source:HGNC Symbol;Acc:1435]
Mouse Orthologue:
Calb2
Mouse Description:
calbindin 2 Gene [Source:MGI Symbol;Acc:MGI:101914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4035 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060160 Nonsense 119 271 5 11
Genomic Location:
Chromosome 18 (position 20986963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAATATTGTTCATATTTTTGTKTGTATCAATAGGCCTGGCGGAAATA[C/A]GATACAGACCGCAGCGGTTTCATTGAGGCTAATGAACTTAAGGTGAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2fsxtqhk