cxcr3.2

Ensembl ID:
ENSDARG00000041041
ZFIN ID:
ZDB-GENE-041114-186
Description:
C-X-C chemokine receptor type 5 [Source:RefSeq peptide;Acc:NP_001007315]
Human Orthologue:
CXCR5
Human Description:
chemokine (C-X-C motif) receptor 5 [Source:HGNC Symbol;Acc:1060]
Mouse Orthologue:
Cxcr5
Mouse Description:
chemochine (C-X-C motif) receptor 5 Gene [Source:MGI Symbol;Acc:MGI:103567]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5887 Essential Splice Site Mutation detected in F1 DNA During 2014
sa253 Nonsense Confirmed mutation in F2 line During 2014
sa8709 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Essential Splice Site 12 378 2 3
ENSDART00000145727 Essential Splice Site 12 219 2 3
Genomic Location:
Chromosome 16 (position 13569805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAAGCTCATCATGGACAACTCAACAACAGCCRCAGAGGTCTCAGCGG[T/C]GAGTTTTAGTTGCCATTAAACTAATACTTTTAAGGGTCCCACTTTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa253
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Nonsense 75 378 3 3
ENSDART00000145727 Nonsense 75 219 3 3
Genomic Location:
Chromosome 16 (position 13573797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGGGTAACATACTTGTGCTTTGTGTTATCCGCCGATATCGCCAATCT[C/T]GACACAGTCCCTGCTCCTTCTCACTGACAGACACCTTCCTGCTACATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Nonsense 206 378 3 3
ENSDART00000145727 Nonsense 206 219 3 3
Genomic Location:
Chromosome 16 (position 13574190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGSAAATTCCTGGCATGAATCGAATGGTGTGCCAAATAGTTTATTCTGAA[C/T]AATACTCCAAGCAATGGCARATTGGTATGCAGCTGGTAAGCATGGTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gc3vinfb