piga

Ensembl ID:
ENSDARG00000041040
ZFIN ID:
ZDB-GENE-040426-1086
Description:
N-acetylglucosaminyl-phosphatidylinositol biosynthetic protein [Source:RefSeq peptide;Acc:NP_001119
Human Orthologue:
PIGA
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class A [Source:HGNC Symbol;Acc:8957]
Mouse Orthologue:
Piga
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class A Gene [Source:MGI Symbol;Acc:MGI:99461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41449 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060134 Nonsense 387 487 6 7
Genomic Location (Zv9):
Chromosome 9 (position 31410908)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30566854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATACGCAGTGGAAATGTGGAGTCTCCTGCTGCCATTCACCGCAAGGTC[C/T]GAACATTGTACACCTGGCGAAACGTTGCTGAGCGCACGGAAAAGGTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link