or111-1

Ensembl ID:
ENSDARG00000041030
ZFIN ID:
ZDB-GENE-000329-16
Description:
odorant receptor, family D, subfamily 111, member 1 [Source:RefSeq peptide;Acc:NP_571668]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35921 Nonsense Mutation detected in F1 DNA During 2016
sa11996 Nonsense Available for shipment Available now
sa32047 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060124 Nonsense 156 326 2 2
Genomic Location (Zv9):
Chromosome 15 (position 30648963)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31470670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGCATTGTCAATAATTCCAATATGATTTTAATTTTCTCAGCAATATG[G/A]GCTTTTAATTCTTCTGTGGTGGCCTTGATGGTGTCTTTGATTGACCGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060124 Nonsense 213 326 2 2
Genomic Location (Zv9):
Chromosome 15 (position 30648792)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31470499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGACATTAGCAAAAATAAGATTATGGCRTATGTCATTTCAGCTATGTA[C/A]ATTATAGCACCAATGGTCGTTATYGTYTTTTCATATCWGGGCATTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060124 Nonsense 314 326 2 2
Genomic Location (Zv9):
Chromosome 15 (position 30648491)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31470198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGTTTTAAACACAGGTGAAATTAAGGACCTAATTCGAAAAATGCTT[A/T]AAAGCAGATCTGCACCGATCAGAGAGAACATTTCCAAATGAGGCTGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link