ENSDARG00000041023

Ensembl ID:
ENSDARG00000041023
Human Orthologue:
NPTN
Human Description:
neuroplastin [Source:HGNC Symbol;Acc:17867]
Mouse Orthologue:
Nptn
Mouse Description:
neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31113 Nonsense Mutation detected in F1 DNA During 2016
sa44333 Nonsense Mutation detected in F1 DNA During 2016
sa8889 Nonsense Mutation detected in F1 DNA During 2016
sa39488 Nonsense Mutation detected in F1 DNA During 2016
sa38105 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060116 Nonsense 61 344 1 18
ENSDART00000097332 Nonsense 15 277 1 23
ENSDART00000060116 Nonsense 61 344 1 18
ENSDART00000097332 Nonsense 15 277 1 23
Genomic Location:
Chromosome 25 (position 30352845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTCCCTCTCCTCCGCATCCCTCACACACATATTCCGGGTCCACGGA[C/T]GACCTAGAAAAATGTCTTTCGCCGGGAATCCATTGGTGATATTAGTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060116 Nonsense 61 344 1 18
ENSDART00000097332 Nonsense 15 277 1 23
ENSDART00000060116 Nonsense 61 344 1 18
ENSDART00000097332 Nonsense 15 277 1 23
Genomic Location:
Chromosome 25 (position 30352845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTCCCTCTCCTCCGCATCCCTCACACACATATTCCGGGTCCACGGA[C/T]GACCTAGAAAAATGTCTTTCGCCGGGAATCCATTGGTGATATTAGTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060116 Nonsense 204 344 12 18
ENSDART00000097332   None 277 None 23
Genomic Location:
Chromosome 25 (position 30333454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGGAGAGGAAAGAAAGACGCGWGGCMGAAAAAGCAGGAGAAAGCACT[A/T]AAAGTGTGCCCAAGTTCATTTCCAGTCCTTTCACAAGCATCCTCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060116   None 344 None 18
ENSDART00000097332 Nonsense 160 277 19 23
Genomic Location:
Chromosome 25 (position 30330571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGGGGTCTAAAAGGTCAAATTGTACTTCCAGTCATTTATATAGAATA[T/A]CCAGGGTATATTATATCAGATTGTGTTTGGAATTTTACTGTACCTGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060116 Essential Splice Site 211 344 13 18
ENSDART00000097332   None 277 None 23
Genomic Location:
Chromosome 25 (position 30328799)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATAAATGATGACAATTTTTTCATTTTTAGGTCAACTATCCCTTCAA[G/A]TATTAAAAAAAAAAAAACACTCAAAGAAGATGAAGCAAAAACACAATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link