pdcd4b

Ensembl ID:
ENSDARG00000041022
ZFIN ID:
ZDB-GENE-030131-9847
Description:
programmed cell death protein 4 [Source:RefSeq peptide;Acc:NP_945329]
Human Orthologue:
PDCD4
Human Description:
programmed cell death 4 (neoplastic transformation inhibitor) [Source:HGNC Symbol;Acc:8763]
Mouse Orthologue:
Pdcd4
Mouse Description:
programmed cell death 4 Gene [Source:MGI Symbol;Acc:MGI:107490]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39379 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32409 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009223 Essential Splice Site 147 470 4 12
Genomic Location (Zv9):
Chromosome 22 (position 32371215)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29732345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGAAGATGAAGTCGATTATAAAGATCCCAATTACGATGCAGAGCAGG[T/G]ATGACCCACATAATACTATTGCTTTCGTAAAAGTTCGTAACCAATACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009223 Essential Splice Site 185 470 5 12
Genomic Location (Zv9):
Chromosome 22 (position 32371018)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29732148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTATCGTGCAGGAGTACTTTGAACACGGAGATGCTAATGAAGTGGCGG[T/A]GAGATTGTTATGACCCCTATTGCTCGTTCATATCTAATCATTAAGCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link